Journal:

Article Title: Brain Lipid Binding Protein in Axon-Schwann Cell Interactions and Peripheral Nerve Tumorigenesis

doi: 10.1128/MCB.23.6.2213-2224.2003

Figure Lengend Snippet: mRNA expression analysis in Nf1 mutant mouse Schwann cells. (A) Microarray analysis was used to compare genome-wide expression levels between normal mouse Schwann cells and Nf1 mutant Schwann cells. The control for each comparison was Cy3-labeled cDNA generated from normal mouse Schwann cell mRNA. For each of four Nf1 mutant Schwann cell samples (Nf1+/−, Nf1−/−, Nf1−/− TXF, and Nf1−/− TXF treated with FTI), mRNA was used as a template to synthesize Cy5-labeled cDNA. Cy3- and Cy5-labeled cDNA probes were hybridized simultaneously to the Incyte Genomics MouseGEM 1.0 cDNA microarray. Relative intensities of Cy3 versus Cy5 fluorescent signals for each cDNA target sequence were analyzed with GeneSpring software. The most changes were observed in the Nf1−/− TXF cells (genes upregulated in Nf1−/− TXF are red; genes downregulated in Nf1−/− TXF are green). Expression of one target cDNA, BLBP (black line), was 26-fold above normal in the Nf1−/− TXF cells and not normalized by FTI treatment. (B) RT-PCR analysis confirmedthe microarray result of elevated BLBP expression in Nf1−/− TXF cells. Reverse transcriptase (RT) was omitted from duplicate samples to control for DNA contamination. Primers for BLBP (∼200-bp amplicon) and actin control primers (∼500-bp amplicon) were included in the mixture for each 40-cycle reaction. The plasmid positive control for BLBP amplification is the UniGEM clone (Incyte Genomics) containing the BLBP cDNA insert spotted on the microarray. (C) Quantitative real-time PCR of BLBP normalized to GAPDH resulted in a 145-fold change over expression in Nf1−/− TXF cells compared to wild-type mouse Schwann cells. Rn, fluorescent signal intensity; horizontal starred line, chosen threshold at geometric phase of amplification.

Article Snippet: In DRGN cocultures, neurofilament was visualized by incubation with anti-NF-15g1 antibodies ( 38 ) diluted 1:5, followed by donkey anti-mouse Cy3-labeled secondary antibodies (Jackson Immunoresearch).

Techniques: Expressing, Mutagenesis, Microarray, Genome Wide, Labeling, Generated, Sequencing, Software, Reverse Transcription Polymerase Chain Reaction, Amplification, Plasmid Preparation, Positive Control, Real-time Polymerase Chain Reaction, Over Expression

Journal:

Article Title: Brain Lipid Binding Protein in Axon-Schwann Cell Interactions and Peripheral Nerve Tumorigenesis

doi: 10.1128/MCB.23.6.2213-2224.2003

Figure Lengend Snippet: Mouse neuron-Schwann cell coculture. Anti-BLBP promotes extension of Nf1−/− TXF cell processes along axons. Wild-type (A and B) or Nf1−/− TXF (C and D) mouse Schwann cells labeled with Cell Tracker green were preincubated with rabbit IgG (A and C) or anti-BLBP antibodies (B and D) and seeded onto DRGN cultures stripped of endogenous Schwann cells. Two days after seeding, cocultures were fixed and stained with antineurofilament antibodies followed by Cy3 (red)-conjugated secondary antibodies. Confocal images obtained with Zeiss LSM Image Browser software are shown. Single cells are representative of the majority observed with each treatment. Arrowheads indicate Schwann cell processes. The asterisk indicates the region which is magnified fivefold in the inset. The scale bar in panel C equals 5 μm and also applies to panels A, B, and D. (E) Lower magnification (scale bar, 5 μm) of Nf1−/− TXF on DRGN cultures in the presence of anti-BLBP antibodies. Arrowheads indicate processes from two cells extending along neurites; other cells lack processes. (F) Extension of Nf1−/− TXF cell processes in the presence of anti-BLBP antibodies is statistically significant. The percentages of Nf1−/− TXF cells extending processes along axons in the presence of control IgG (gray bar) or anti-BLBP antibodies (black bar) are graphed. Error bars reflect standard deviations in a Student t test (P = 0.003).

Article Snippet: In DRGN cocultures, neurofilament was visualized by incubation with anti-NF-15g1 antibodies ( 38 ) diluted 1:5, followed by donkey anti-mouse Cy3-labeled secondary antibodies (Jackson Immunoresearch).

Techniques: Labeling, Staining, Software

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate C2C12 cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Transfection, Cell Culture, Staining, Immunostaining, Infection, Expressing, Quantitative RT-PCR, Western Blot

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 3. E2f4 Is a Direct Transcription Target of MyoD/Myf5 MPCs used below Were Isolated by FACS from 2-Month-Old Wild-Type Mice (A) Sorted cells were fixed after either 1 hr of plating (i.e., quiescent satellite cells or QSC) or 1 day of culturing (i.e., activated satellite cells or ASC) followed by immunostaining for E2F4 (green). (B) MPCs from three mice were separately infected with adenoviruses expressing indicated shRNAs; 36 h later, the E2f4 mRNA levels were measured by qRT-PCR. (C) MPCs were transfected with siRNAs as indicated. E2F4 protein levels were measured by western blotting. (D) Top: schematic of the E2f4 promoter. TSS, transcription start site; blue boxes, exons; black box, the E box. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with a MyoD antibody or an immunoglobulin G control. The fold enrichment of MyoD on the specific E box in the E2f4 promoter is shown. NS, non-specific site. (E and F) MPCs (E) and C2C12 myoblasts (F) were transfected with siRNAs as indicated; 24 hr post transfection, cells were cultured in the pro-adipogenic media for 4 days followed by oil red O staining. Data are presented as mean ± SD. **p < 0.01, ***p < 0.001. Scale bars, 30 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Immunostaining, Infection, Expressing, Quantitative RT-PCR, Transfection, Western Blot, Control, Cell Culture, Staining

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 4. Prdm16 Is a Direct Transcription Target of the E2F4/p107/p130 Repressive Complex (A) FACS-isolated MPCs in triplicate were transfected with siRNAs as indicated. Relative gene expression was measured by qRT-PCR 24 hr after transfection. (B) Top: schematic of the Prdm16 promoter. #1 and #2 indicate the predicted E2F4 binding sites (black boxes). Blue box, exons. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with specific antibodies as indicated. The fold enrichment of E2F4, p107, or p130 on two potential E2F4 binding sites in the Prdm16 promoter and a known E2F4 binding site in the PPARg promoter (control) is shown. (C–F) C2C12 cells in triplicate were co-transfected with various luciferase reporters, siRNAs, and/or cDNA expression vectors as indicated. Cells were harvested 24 hr after transfection and luciferase activities were measured. In (C) and (D), a luciferase reporter construct carrying a 1.5-kb mouse Prdm16 proximal promoter was used. In (E), two luciferase reporter constructs were used, each carrying a short fragment of the Prdm16 promoter with one of the two (i.e., #1, #2) potential E2F4 binding sites. In (F), two luciferase reporter constructs were used, one carrying three copies of the wild-type E2F4 binding site (CGCAGC) found in site #2 and the other three copies of the mutated E2F4 binding site (CTCCTC). In (A)–(F), Fold changes were calculated. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Transfection, Gene Expression, Quantitative RT-PCR, Binding Assay, Control, Luciferase, Expressing, Construct

Journal: bioRxiv

Article Title: The emerging fungal pathogen Candida auris induces IFNγ to colonize mammalian hair follicles

doi: 10.1101/2025.01.15.632653

Figure Lengend Snippet: (A) Mice were colonized on days 0,2,4,6 with C. albicans and back skin was harvested for CFU on day 14 (8 days after the final application). Mice that lack IL-17 receptor on keratinocytes (Ker14 Cre ;IL17Ra F/F , i.e. Ker14 ΔIL17Ra ) were colonized alongside littermate controls (IL17Ra F/F lacking Cre recombinase) and IL-17-/- mice, which globally lack IL-17a and IL-17f. (B) Representative photographs of back skin from Ker14 ΔIL17Ra and littermate controls at day 14. (C) Schematic cartoon showing keratinocyte subsets. (D) From scRNAseq, keratinocytes were pre-selected and further analyzed to reveal subset clusters: hair follicle bulge, isthmus, infundibulum, basal layer, spinous layer, sebaceous gland (SG), and proliferating. (E,F) scRNAseq dot plot by (E) treatment condition or (F) cell type, showing modules upregulated following C. albicans colonization associated with epithelial stem cells, differentiation, migration and cornification associated modules and anti-Candida defenses. (G) Schematic showing experimental design where Lrig1 CreERT ; R26 Tdt mice were injected with tamoxifen 1 day prior to mock, C. auris or C. albicans colonization. Mice were harvested for confocal microscopy on day 5 post colonization. (H) Representative image from slices of 3D image showing lineage traced Lrig1+ cells 1-day post tamoxifen (I) Top panel showing representative 3D image of lineage traced Lrig1+ cells 5 days post-colonization with mock, C. auris, or C. albicans . Bottom panel showing overlapping Lrig1 and CD49f epithelial surface, using Imaris imaging software. (J) Graphical representation of overlapping Lrig1 + surface with the CD49f + epithelia surface subdivided into the hair follicle and interfollicular epidermis, using Imaris imaging software. (K) Schematic showing proposed C. albicans induced changes to keratinocytes. *P<0.05, **P<0.01, ****P<0.0001 for one-way analysis of variance (ANOVA) and Tukey’s multiple comparison test (A,I).

Article Snippet: To generate keratinocyte specific knock out of IL-17 and IFNγ signaling, we crossed Ker14 Cre mice (B6N.Cg-Tg(KRT14-cre)1Amc/J) from Jackson with Il17Ra floxed mice (B6.Cg-Il17ratm2.1Koll/J; MGI:J:237978) and IFNγR1 floxed mice (C57BL/6N-Ifngr1tm1.1Rds/J, MGI:J:206257) from Jackson Labs. To track type 1 lymphocytes we used Tbet (Tbx21)-zsGreen transgenic mice (generously provided by Jinfang Zhu, Lab of Immune System Biology, NIH).

Techniques: Migration, Injection, Confocal Microscopy, Imaging, Software, Comparison

Journal: bioRxiv

Article Title: The emerging fungal pathogen Candida auris induces IFNγ to colonize mammalian hair follicles

doi: 10.1101/2025.01.15.632653

Figure Lengend Snippet: (A-C) scRNAseq dot plot of epithelial cells separated by (A) fungal colonization type or (B) epithelial cell type or (C) IFNγ -/- , WT, IL-17 -/- , and IFNγ OE genotype. Mice were treated with Candida spp indicated on days 0,2,4,6 and back skin was harvested on day 14. (D) Representative 3D confocal microscopy of Stat1 expression in the upper hair follicle in WT mice treated with either mock colonization or C. auris colonization on day 14. (E) Correlation between Stat1 expression, assessed via mean fluorescence index (MFI), and CD8 T cells per hair follicle. (F) Quantitation of Stat1 mean fluorescence intensity (MFI) per hair follicle in mice indicated. WT C. auris colonized mice were subdivided based on having less than or greater than 15 CD8 T-cells per hair follicle. (G) Stat1 MFI in the epithelial surface (CD49f) compared to all other skin structures (non-CD49f). (H) Stat1 MFI between the interfollicular epithelium (IFE), upper hair follicle, and lower hair follicle in mock colonized (white) and C. auris colonized (red) mice. (I,J) Schematics showing models used to test colonization and epicutaneous infection. For epicutaneous infection, intact back skin was pre-colonized with C. auris on day 0,2,4,6; on day 14, hair was removed, and the skin was abraded with sandpaper. C. auris was reapplied on day 15 and back skin was harvested 2 days later for fungal burden. For ‘Re-Colonization’, intact back skin was pre-colonized with C. auris on days 0,2,4,6 and intact back skin was re-colonized on day 14. Back skin was harvested for fungal CFU 5 days after final colonization. Graph showing fungal burden (CFU) after C. auris (I) epicutaneous infection and (J) recolonization of B6 wild type (WT), IFNγ -/- , IL-17 -/- mice, IFNγ OE mice (Yeti/+), and Ker14 ΔIFNγR1 (Ker14 Cre ;IFNγR1 Flox ). (K) IFNγ overexpressing mice ( IFNγ OE ) colonized with C. auris , at day 14 with numerous yeast forms at the hair follicle orifice. *P<0.05, ****P<0.0001 for one-way analysis of variance (ANOVA) and Tukey’s multiple comparison test (F) . In (E), statistics shown comparing C. auris <15 CD8 per hair follicle to all other groups. **P<0.01, ***P<0.001 for Kruskal-Wallis test with Dunn’s multiple comparison test (I,J) . *P<0.05, **P<0.01 student T-Test (G,H). *P<0.05, **P<0.01 Mann-Whitney Test (I,J) .

Article Snippet: To generate keratinocyte specific knock out of IL-17 and IFNγ signaling, we crossed Ker14 Cre mice (B6N.Cg-Tg(KRT14-cre)1Amc/J) from Jackson with Il17Ra floxed mice (B6.Cg-Il17ratm2.1Koll/J; MGI:J:237978) and IFNγR1 floxed mice (C57BL/6N-Ifngr1tm1.1Rds/J, MGI:J:206257) from Jackson Labs. To track type 1 lymphocytes we used Tbet (Tbx21)-zsGreen transgenic mice (generously provided by Jinfang Zhu, Lab of Immune System Biology, NIH).

Techniques: Confocal Microscopy, Expressing, Fluorescence, Quantitation Assay, Infection, Comparison, MANN-WHITNEY